Skip to main content

Advertisement

Table 1 Characterization of VEGF polymorphisms, probes and primers sequences for genotyping by TaqMan real time PCR

From: Role of vascular endothelial growth factor polymorphisms (-2578C > A, -460 T > C, -1154G > A, +405G > C and +936C > T) in endometriosis: a case–control study with Brazilians

Identified SNP TaqMan assays Region Probe [SNP] Primer
rs699947 C_8311602_10 PR GCCAGCTGTAGGCCAGACCCTGGCA[A/C]GATCTGGGTGGATAATCAGACTGAC 5′-GGATGGGGCTGACT AGGTAAGC-3′
5′-AGCCCCCTTTTCCT CCAAC-3′
rs833061 C_1647381_10 PR GAGTGTGTGCGTGTGGGGTTGAGGG[C/T]GTTGGAGCGGGGAGAAGGCCAGGGG 5′-TGTGCGTGTGGGGTTGAGAG-3′
5′-TACGTGCGGACAGGGCCTGA-3′
rs1570360 C_1647379_10 PR AGCCCGGGCCCGAGCCGCGTGTGGA[A/G]GGGCTGAGGCTCGCCTGTCCCCGCC 5′-TCCTGCTCCCTCCT CGCCAATG-3′
5′-GGCGGGGACAGGC GAGCATC-3′
rs2010963 C_8311614_10 5′-UTR CGCGCGGGCGTGCGAGCAGCGAAAG[C/G]GACAGGGGCAAAGTGAGTGACCTGC 5′-TTGCTTGCCATTCCCCACTTGA-3′
5′-CCGAAGCGAGAACAGCCCAGAA-3′
rs3025039 C_16198794_10 3′-UTR GCATTCCCGGGCGGGTGACCCAGCA[C/T]GGTCCCTCTTGGAATTGGATTCGCC 5′-AAGGAAGAGGAGAC TCTGCGC-3′
5′-TATGTGGGTGGGT GTGTCTACAG-3′
  1. PR is Promoter Region, 5′-UTR is 5′-Untranslated Region, 3′-UTR is 3′-Untranslated Region.