Skip to main content

Advertisement

Table 1 Primer information

From: Nontuberculous mycobacterial infection in a clinical presentation of Fitz-Hugh-Curtis syndrome: a case report with multigene diagnostic approach

Gene Exon Forward Reverse Amplicon size (bp)
IFNGR1 1 CGGTGACGGAAGTGACGTA AACCGACGAGTTCAAACCAC 372
2 GGCAATGTGGCATCTTACAA TGGGAAGGCTGATGAAAGAA 292
3 CTTTCTCTGGCGTCTCCATC TTTGGAGCATTCTGGGTTTC 495
4 TGGTTTAAATGTGGTCCTGCT TGATCTGTGAGTCTTGCTTGAA 427
5 TGCATAGTATCGTGCTGTGTTG TGCAAATGAGTTTGCTTTCC 453
6 CCTAACTTCTGCTTCCTTCAGTG GGCAGGTGACATCTTGTTGA 389
7-1 GCCATTTGGTGGTCCATTAC GGAGGTGGGGGCTTTTATTA 599
7-2 GCAGCCATCTGACTCCAATAG TCACTCCATTTGGTTGATACC 489
IFNGR2 1 GAGCCGAATCCCCTCCAC TGATCTGAGCACTCCGCATA 401
2 TGCCATTTCTGCACTTTGAC AACCCGTGTGGTTAGACAGC 496
3 GGGTGACAGAGCAAAACTCC TTTAGGGTGACAGGCAGGAC 482
4 TCGCACAACTGCACTCTAGC CTCAGCCTCTATGGGGACAC 489
5 TCTGAGACCTCACAGCCAGA CTCATAAGCATTCCCCGATT 473
6 TAAGCAGCATGGATGGAACA AAAATTAGCAGGCCATGGTG 429
7 CCAGCCTAGGCAAGAGTAAGA CAGGGACAGGCCTTTTAGAG 398
STAT1 3 TGTGTTTCGTGGAGGAGAAA GTAAACATGGCCCCAAGTCA 422
4 CTGCTGCTAAAAGCAATGTCA TGTGCTCAATTGTATTTGCTGA 392
5 CCCGGAGAATATAAACAAATTCA CTCCCACTTCTTGGGGCTAT 327
6 ACAGTTTGCCAGCATTTTCC GAGGTTTACACCCCAAGCAA 351
7 CGTGTTTCTCTGGGTTCCAT TAAAAGTCGGGGATGCTGTT 405
8 GACTACAGGCGTCTGCCACT TCATTCTCAACTGGGGCTCT 448
9 GAGCCCCAGTTGAGAATGAA TTCCAAGGGAGTGTTTCCAG 420
10 CCATGATTCCCTTTAATCCAG TTAAACCCTTGTAAATCATCTGAA 323
11 GATCGTACTCTCTAACCCCCTTT GCATTACATTTATGATTGGAAAAA 439
12 CCTAAAACTGGAGGGGGAGT AAATCTGCTGGGGTCATTTG 410
13 GGCTGCAAATCCATAGGTGT GCCCAAAATGTTGAACTTCC 285
14 TGCAGAGATGTGAATGAGAGAAA CAGTCGTGGGATAAGGAGGA 407
15 GCCAATTTGTCCCATGTTCT CAAATACCCAGCTCCTTTGC 324
16 TGTGGCCTGTTGCAATGTTA CATCAGCGATCTCAACTGGA 400
17 TCCCCTGCTTTTAGTTGAGG ACTGCCCTAGCTTACCCACA 410
18 CCCCTACTGTGAAAGCACCT TAGCAGAGGGGAAAAGAGCA 348
19 CCATTTAAATTCCGCCCTCT CCTTGGCCAGAGAAGAACAC 382
20 TGTGCTGAATGGGACAGTTC CTGAAGGGGCAGCCTATAAA 357
21 CATTCCAGCCATTTTCTTGG TTCATGTCCCAAACGCACTA 340
22 CACTCAAATCCATCAACTCTGC TCGAAAGCAAAACACTGCAT 377
23 TGACTCAGGCAGGGAGGTTA TTCAGCTGTGATGGCGATAG 351
24 CACATCCCTGGAGTGTGAAA CTCCAACTTGTCATGGCTCA 481
  25 CCAGTGGGCAGCAGAGTAAT TGCTGGCCTTTCTTTCATTT 362