Skip to main content

Table 1 List of primer sequences used for qPCR [26]

From: Myometrial progesterone hyper-responsiveness associated with increased risk of human uterine fibroids

Gene Name Function Forward primer (5–3) Reverse primer (5--3)
FOXO1A Forkhead box O1A Transcription factor in induction of apoptosis AAGAGCGTGCCCTACTTCAA CTGTTGTTGTCCATGGATGC
SCGB2A2 Secretoglobin, family 2A, member 2 A uteroglobin-related genes ACCATGAAGTTGCTGATGGTC GGCATTTGTAGTGGCATTGTC
  Control cell cycle and DNA replication.
CIDE cell death-inducing DFFA-like effector c Induce apoptosis AAGTCCCTTAGCCTTCTCTACC CCTTCCTCACGCTTCGATCC
CAPN6 Calpain 6 It is calcium-activated cysteine proteinases GGAAGCGTCCACAGGACATTT TCATTGCCTTGTTCCCCAATC
CYP26a1 cytochrome P450, family 26, subfamily a, polypeptide1 RA catabolizing enzyme AGAGCAATCAAGACAACAAGTTAG ATCGCAGGGTCTCCTTAAT
ALDH1a1 Aldehyde dehydrogenase family 1, subfamily A1 RA synthesis enzymes GCACGCCAGACTTACCTGTC CCTCCTCAGTTGCAGGATTAAAG
ADH5 Aldehyde dehydrogenase family5 RA synthesis enzymes ATGGCGAACGAGGTTATCAAG CATGTCCCAAGATCACTGGAAAA
MT1E Metallothionein 1E Metallothioneins (MTs) family that bind to heavy metal ions and minimize reactive oxygen species. GCAAGTGCAAAAAGTGCAAAT CACTTCTCTGACGCCCCTTT
HHI () Indian hedgehog down regulation of cellular division AACTCGCTGGCTATCTCGGT GCCCTCATAATGCAGGGACT
Calcitonin   Reduce production of pro-inflammatory cytokines, protective factor in ischemia CCTATCCAACAATAGAGCCCAAG TGCATTCGGTCATAGCATTTGTA
MMP11 Matrix metalloproteinases Regulate cell-cell interactions and release the growth factors AGACACCAATGAGATTGCAC GCACCTTGGAAGAACCAAATG