Skip to main content
Download PDF

Investigation of the interaction between Genetic Risk Score (GRS) and fatty acid quality indices on mental health among overweight and obese women

BMC Women's Health volume 23, Article number: 413 (2023) Cite this article

Abstract

Background & aims

Mental disorders are associated with dietary fatty acids and genome-wide association studies have found multiple risk loci robustly related to depression, anxiety, and stress. The aim of this study is to investigate the interaction of genetic risk score (GRS) and dietary fat quality indices on mental health.

Methods

This cross-sectional study included 279 overweight and obese women for N6/N3 ratio and 378 overweight and obese women for CSI aged 18–68 years. Using reliable and verified standard protocols, body composition, anthropometric indices, blood pressure, physical activity, and dietary fat quality were measured. Serum samples were used to determine biochemical tests. A genetic risk score (GRS) was calculated using the risk alleles of the three SNPs. A generalized linear model (GLM) was applied to assess the interactions between GRS and fat quality indices. Mental health was evaluated using Depression Anxiety Stress Scales (DASS-21).

Results

The mean (± SD) age and BMI of our participants were 36.48 (8.45) and 30.73 (3.72) kg/m2 respectively. There was a marginally significant mean difference among tertiles of the CSI in terms of stress (P = 0.051), DASS-21 (P = 0.078) in the crude model. After adjusting for age, energy intake, physical activity and BMI in model 1, there was a positive interaction between GRS and T3 of N6/N3 ratio on anxiety (β = 0.91, CI = 0.08,1.75, P = 0.031), depression (β = 1.05, CI = 0.06,2.04, P = 0.037), DASS-21 (β = 2.22, CI= -0.31,4.75, P = 0.086).

Conclusion

Our findings indicate that higher ratio of N-6 to N-3 considering genetics were predictive of mental disorder in our population.

Peer Review reports

Introduction

Depression and anxiety are the most frequent psychiatric disorders [1], which are significantly characterized by psychological symptoms including decreased mental activity, mood changes, cognitive impairment, phobia, fatigue, and heart palpitations [2, 3]. The global worldwide prevalence of depression, anxiety, and stress has been reported 60.8%, 73%, and 62.4%, respectively. According to a population-based studies in Iran, the prevalence of depression and anxiety has been estimated 4.1% and 15.6%, respectively [4,5,6]. Among the various factors related to mental disorders, genetic variations and dietary intake play an important role [7, 8].

Lipids are involved in the function of neurons in the brain, which lead to depression and anxiety-related behaviors by reducing membrane fluidity [9]. A new dietary fat quality index as Cholesterol-Saturated Fat Index (CSI) was proposed by Connor et al. during the previous decade [10]. This index is known as a dietary self-monitoring tool, which indicates the content of dietary cholesterol and saturated fat. A lower CSI is related to lower saturated fat and cholesterol, and low atherogenicity [10]. Alongside CSI, the omega-6/omega-3 essential fatty acids (EFA) ratio was introduced by Simopoulos et al. The N6/N3 ratio measures the balance between omega-6 and omega-3 polyunsaturated fatty acids in the diet, which are important for brain function and inflammation regulation. In general, a higher N6/N3 ratio indicates a higher intake of omega-6 fatty acids than omega-3 fatty acids, while a lower ratio indicates a higher intake of omega-3 fatty acids [11]. Several studies evaluated the effects of dietary fatty acids on mental disorders and found controversial results. Previous studies have shown that daily intakes of EPA and DHA supplementation have an effective role in decreasing depressive symptoms in patients with anxiety, major depressive disorder, and stress [12,13,14]. On the other hand, the results of a meta-analysis of 31 trials indicated that long-chain omega-3 fatty acids consumption may have no significant effect on preventing symptoms of mental disorders such as depression or anxiety [15]. Based on another review of 34 studies, there is currently insufficient and reliable evidence of the effect of omega-3 fatty acids in the prevention and treatment of the depressive disorders [16]. Studies have proven that saturated fatty acids (SFA) negatively affect membrane fluidity and brain functions [17]. A positive association was indicated between SFAs and increased symptoms of depression and anxiety disorders [18, 19]. Of note is that, genetic factors have been known as a significant risk factor for mental disorders [8]. Developments in genome-wide association studies (GWAS) have provided the investigation of genetic risk scores (GRS),which are considered for each single nucleotide polymorphism (SNP) with the collection of risk alleles [20]. Sum of 30 depression-related SNPs were contained in a GRS to investigate and predict depression disorder risk in one study [21]. Here, three new genes of Cryptochrome (CRY), Melanocortin-4 Receptor (MC4R), and Caveolin (CAV) were associated with mental disorders-related SNPs in GWAS [22,23,24]. Other authors found significant associations between GRS with major depression [20, 25], anxiety [26], and stress [27]. Regarding the “gene-environment interaction” hypothesis [28], dietary fatty acids are related to GRS [29]. Based on the high prevalence rates of depression and anxiety globally and in Iran and its impact on individuals and society, there remains a critical gap in understanding the complex interplay between genetic factors and dietary intake in the context of mental health. This gap needs to be addressed in order to uncover novel insight into the underlying mechanisms of mental disorders and to develop targeted interventions and preventative measures. However, to the best of our knowledge, there is no literature on the interaction between GRS and dietary fat quality index on mental disorders. Therefore, the aim of this study is to investigate the interaction between GRS including MC4R (rs17782313), CAV-1 (rs3807992), and Cry-1 (rs2287161) with dietary fat quality indices based on CSI and omega-6/omega-3 EFA ratio in relation to mental health, particularly among overweight and obese individuals.

Materials and methods

Study population

This cross-sectional study included 279 overweight and obese women for N6/N3 ratio and 378 overweight and obese women for CSI who were referred to health centers of Tehran University of Medical Science. The inclusion criteria were as follows: body mass index (BMI) of 25 to 40 kg/m2 and in the 18–68 age range. The exclusion criteria were as follows: history of cardiovascular or thyroid disease, malignancies, hepatic or renal disease, all types of diabetes, acute or chronic diseases, presence of menopause, pregnancy or lactation, following a specific diet or supplement usage to lose weight over the past year, glucose and lipid lowering drugs, medicine consumption for hypertension, and smoking. Written informed consent was obtained from all subjects. The protocol of the study was approved by the ethics committee of the TUMS (Ethics number: IR.TUMS.VCR.REC.1399.636). All methods were performed in accordance with relevant guidelines/regulations.

Anthropometric and blood pressure measurements

Bioelectrical impedance analyzer (BIA) (InBody 770 scanner from InBody Co. (Seoul, Korea)) was used to analyze body composition and weight, body fat mass, fat-free mass, body fat percent, and visceral fat of the participants by following the manufacturer’s protocol [30]. Participants were asked to remove metal objects such as rings, earrings, and watches as well as coats, sweaters, and shoes. Moreover, the height was measured using a non-elastic tape, to the nearest to 0.5 cm, in a standing position and unshod. For measuring the BMI, the weight (in kilograms) was divided into height squared (in square meters). According to World Health Organization, overweight was defined BMI 25-29.9 kg/m2 and obesity grades 1, 2, and 3 were defined as BMI 30-34.9 kg/m2, BMI 35-39.9, and BMI 40 kg/m2, respectively. Waist circumference (WC) and hip circumference, respectively, were measured, after expiration, in the narrowest area of the torso and maximum posterior extension of the buttocks, with accuracy of 0.5 cm. The waist-to-hip ratio (WHR) was calculated by dividing the waist circumference (cm) by hip circumference (cm). Blood pressure (BP) was measured for two times after 5 min rest, using an appropriate cuff. Averaged value of the two readings was recorded.

Physical activity assessment

Participant’s physical activity (PA) was appraised using a reliable and validated international physical activity questionnaire-short form (IPAQ) through a face-to face interview. The metabolic equivalent hours per week (METs-h / week) was measured for each individuals in the last week [31].

Biochemical and hormonal determination

Serum samples were collected after overnight fasting (10–12 h) at the Nutrition and Biochemistry Laboratory of the School of Nutritional and Dietetics, TUMS. All samples were centrifuged, stored at − 80 °C, and analyzed via a single assay technique. We measured fasting blood glucose (FBS) using glucose oxidase-phenol 4-aminoantipyrine peroxidase (GOD-PAP) and Triglyceride (TG) was assayed using glycerol-3-phosphate oxidase–phenol 4-aminoantipyrine peroxidase (GPOPAP) enzymatic endpoint. Direct enzymatic clearance assay was used to measure high-density lipoprotein (HDL), low-density lipoprotein (LDL), and total cholesterol. Standard protocols were applied to measure insulin and hs-CRP. The homeostatic model assessment insulin resistance (HOMA-IR) was used to assess insulin resistance (mIU/ml), with the following formula: [fasting plasma glucose (mmol/l) × insulin (IU/l)] / 22.5) [32]. All evaluations were performed using Randox Laboratories (Hitachi 902) kits.

Mental health assessment

Mental health status of participants was determined using the 21-item self-report version of the Depression Anxiety Stress Scales (DASS-21), a valid tool that provides states of depression, anxiety, and stress [33]. To identify the final score, DASS-21 scores were multiplied by two and divided in to three categories as cutoff points for having depression (≥ 10), anxiety (≥ 8), and stress (≥ 15).

Dietary intake assessment

We used a 147-item validated semi-quantitative standard food frequency questionnaire (FFQ) to evaluate dietary intakes of all participants over the preceding year [34]. This questionnaire was completed by an expert dietician and subjects reported the frequency of each food item on a daily, weekly, monthly, or yearly basis. The extracted FFQ values were then entered into an excel program which determined the weight (grams) of each food item. Total energy, macronutrients, and micronutrients were analyzed using the NUTRITIONIST 4 (First Data Bank, San Bruno, CA) food analyzer [35].

Dietary fat quality indices

Both cholesterol-saturated fat index (CSI) and the ratio of omega-6/omega-3 (N-6/N-3) essential fatty acids are considered dietary fat quality indices which are calculated by following formulas:

  • CSI: represents the cholesterol and saturated fat content of food, which helps a person in self-care against high levels of cholesterol [36].

CSI = Cholesterol / Saturated fat

  • The N-6 to N-3 ratio: Omega 6 and Omega 3 are two essential fats, categorized as PUFAs [37, 38].

N-6 to N-3 ratio: total Omega 6/ total Omega

Genotyping and GRS

DNA was extracted from whole blood samples by using salting out methods [39]. The integrity and concentration of extracted DNA were assessed using 1% agarose gel and the Nanodrop 8000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA), respectively. Single nucleotide polymorphisms (SNPs) were genotyped using the TaqMan Open Array (Life Technologies Corporation, Carlsbad, CA, USA) [40]. The forward primer of CAV-1 (rs3807992) is 3′AGTATTGACCTGATTTGCCATG 5′ and the reverse primer is 5′ GTCTTCTGGAAAAAGCACATGA 3′. The fragments containing three genotypes including GG, AA, and GA were distinguished. The forward and reverse primers of Cry1 (rs2287161) are 5′-GGAACAGTGATTGGCTCTATCT − 3′ and 5′-GGTCCTCGGTCTCAAGAAG-3′, respectively. Pieces containing three genotypes were distinguished: CC, GG, and GC. Based on a previous study, the MC4R gene primer was determined [41]. The sequence of MC4R (rs17782313) primers used are as follows: primers forward: 5- AAGTTCTACCTACCATGTTCTTGG-3; reverse: 5-.

TTCCCCCTGAAGCTTTTCTTGTCATTTTGAT-3. Then, Fragments concluding three genotypes were detected: CC, TT, and CT. Finally, we computed the GRS by summing up three SNPs [CAV-1 (rs3807992), Cry-1 (rs2287161), and MC4R (rs17782313)] that, based on GWAS and other studies, had been linked to obesity-related traits [42,43,44]. Each SNP was coded as 0, 1, or 2 according to the risk alleles for higher BMI. The unweighted GRS was determined using the risk alleles of the three SNPs. The GRS ranges from 0 to 6 and higher scores reflect greater genetic predisposition to high BMI on the GRS scale [45].

Statistical analyses

All data were analyzed by SPSS version 23.0 (SPSS, Chicago, IL, USA), and a P-value < 0.05 was considered statistically significant and interaction P-value < 0.1 was set as mariginally significant. The Kolmogorov-Smirnov test was utilized to find out the normality distribution of data. Demographic characteristics of participants were reported by mean ± standard deviation, minimum and maximum. A one-way analysis of variance (ANOVA) test was used to compare anthropometric indices, FBS, BP, and lipid profile between participants. Analysis of covariance (ANCOVA) was applied to remove confounding results. A generalized linear model (GLM) was used in both crude and adjusted models to assess the interactions between GRS and fatty acid quality indices. The results were adjusted for energy intake, age, BMI, and PA.

Results

Study population characteristics

A total of 279 overweight and obese women for N6/N3 ratio and 378 overweight and obese women for CSI aged enrolled in this cross-sectional study. The mean (± SD) age, height, weight, and BMI of partici pants were 36.48 (8.45), 161.32 (5.82) cm, 79.99 (10.88) kg, 30.73 (3.72) kg/m2, respectively. Also, the mean (± SD) of biochemical variables including FBS, TG, HDL, LDL, TC, and hs-CRP of participants was 87.25 (9.66), 121.12 (69.84), 46.68 (10.61), 94.25 (23.84), 183.71 (35.80), and 4.77 (4.69), respectively. In terms of job and education, most participants were housekeeper 164 (58.8%), bachelor’s degree and higher 132 (47.3%), respectively.

General characteristics of study population according to tertiles of CSI and N6/N3

The baseline characteristics of study participants, categorized according to tertiles of CSI and N6/N3 and GRS, were presented in Table 1. As shown in this table, in the crude model, there was a significant mean difference among tertiles of the CSI in terms of age (P = 0.018), and the significant mean difference in terms of FFM (P = 0.009) and marginally significant for PA (P = 0.082), height (P = 0.058), WHR (P = 0.075) were observed among tertiles of the N6/N3. After adjustment with confounders, including age, BMI, physical activity, and energy intake, the education (P = 0.009) of participants among tertiles of the CSI became significant, and there was a significant mean difference in terms of HOMA index (P = 0.033) and the marginally significant for FBS (P = 0.055) among tertiles of the N6/N3.

Table 1 General characteristics of study population according to tertiles of CSI (378) and N6/N3 (279) in obese and overweight women
Full size table

Dietary intake of study population according to tertiles of CSI and N6/N3

Dietary intakes of participants among tertiles of CSI and N6/N3 ratio were presented in Table 2. After adjustment with the energy intake, mean differences of refined grains, high fat dairy, low-fat dairy, fish, poultry, egg, fast food, red meat, protein, carbohydrate, total cholesterol, polyunsaturated fatty acid (PUFA), saturated fatty acid (SFA), linoleic acid, eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA) (P = 0.001), vegetables (P = 0.003), sweet desert (P = 0.044), total fat (P = 0.006), oleic acid (P = 0.009) were significant across tertiles of CSI, also a significant mean difference was observed among tertiles of the N6/N3 in terms of fruits (P = 0.046), sweet desert (P = 0.035), monounsaturated fatty acid (MUFA) (P = 0.034), PUFA (P = 0.029), oleic acid (P = 0.027), linoleic acid (P = 0.030).

Table 2 Dietary intake of study population according to tertiles of CSI (378) and N6/N3 (279) in obese and overweight women
Full size table

Psychological disorders of study participants according to tertiles of CSI and N6/N3

The psychological disorders of study participants according to tertiles of CSI and N6/N3 were presented in Table 3. In the crude model, a marginally significant mean difference was observed among tertiles of the CSI in terms of stress (P = 0.051), DASS-21(P = 0.078), and there were no significant differences in any other variables across tertiles of CSI and N6/N3 (P > 0.05). After adjusting with confounders (age, energy intake, BMI, and physical activity) the mean differences of stress, anxiety, depression, DASS-21 across tertiles of CSI and N6/N3 were not significant (P < 0.05).

Table 3 Psychological disorders of study participants according to tertiles of CSI (378) and N6/N3 (279) in obese and overweight women
Full size table

The interaction between GRS with tertiles of CSI and N6/N3 on psychological disorders

The interaction between GRS with tertiles of the CSI and N6/N3 ratio on psychological disorders were presented in Table 4. In the crude model, a positive interaction was observed between GRS and T3 of N6/N3 ratio on anxiety (β = 0.79, CI = 0.02,1.57, P = 0.044), depression (β = 1.08, CI = 0.14,2.02, P = 0.023), DASS-21 (β = 2.52, CI = 0.17,4.88, P = 0.036). After adjusting for age, energy intake, physical activity and BMI in model 1, the interaction between GRS and T3 of N6/N3 ratio on anxiety (β = 0.91, CI = 0.08,1.75, P = 0.031), depression (β = 1.05, CI = 0.06,2.04, P = 0.037), DASS-21 (β = 2.22, CI= -0.31,4.75, P = 0.086) remained positive. By contrast, GRS in the interaction with tertiles of CSI showed no significant interaction on stress, anxiety, depression, DASS21, not in the crude model, and even after adjustment in model1.

Table 4 The interaction between GRS with CSI (378) and N6/N3 (279) on psychological disorders in obese and overweight women
Full size table

Discussion

This cross-sectional study aimed to investigate the interaction between fatty acid quality indices and GRS based on BMI-linked genetic markers, namely, MC4R (rs17782313), CAV-1(rs3807992) and Cry-1 (rs2287161) on mental health in overweight and obese women. We discovered that dietary fatty acid quality evaluated by N-6/N-3 ratio regarding genetic predisposition were predictive of mental disorder in our population.

Our findings revealed a positive significant interaction between greater GRS with high ratio of N-6 to N-3 on anxiety, depression, and Dass-21. There was no significant interaction in terms of CSI with mental variables, though. Given the lack of previous research on the fatty acid quality indices and mental health and even less reflected the relationship of the mental abnormalities with lipid profiles regarding genetic susceptibility, our results shed light on an unknown interaction between dietary fat quality measurements and genetic predisposition on mental disorders. According to a previous study, consumption of a high fat diet, compared to a normal diet, in mice led to more secretion of CAV-1 in adipose tissue [46]. Apart from that, CAV-1 expression has been shown to be involved in depression [47] and CAV-1 knockdown could reverse the development of this disorder [48]. MC4R is expressed in different parts of central nervous system, such as hypothalamus, brain stem, cerebral cortex, and spinal cord [49]. A non-significant interaction was observed between MC4R minor allele and daily increased fat intake with high stress in Korean adults [50]. Considering Cry-1 rs2287161, Soria et al. demonstrated association between this marker with the susceptibility of the Major Depressive Disorder (MDD) [51]. One publication among British participants indicated a genetic-based direct association between increased lipid metabolism abnormalities and serum total cholesterol with MDD [52]. The association of BMI together with a GRS has also been shown to predict depression and phobic anxiety [53,54,55,56]. One explanation for this association depends on the possible positive relationship between BMI-related genes and promoting obesity with intake of total dietary fat, as the least-satiating macronutrient [57, 58], and SFAs [59,60,61]. Similarly, it has been reported that people with a high SFA intake and elevated scores of obesity GRS had higher BMI compared with people with low SFA consumption [62]. On the other hand, in three large prospective cohorts of US participants, long-chain n–3 PUFA intakes were found to attenuate the genetic association with long-term BMI and weight changes [63].

Genetic liability for psychotic disorders is hypothesized to be related to immune dysregulation [64, 65]. The negative health outcomes of abovementioned higher BMI and obesity on brain function might be explained by inflammation processes [66]. More so, an imbalance of omega-6 and omega-3 PUFA through inflammatory cytokine overproduction have been shown to be involved in the pathology of depression [67] and have worse impact on cognition [68,69,70,71]. Notably, it has been reported that higher N-6/N-3 ratio was correlated with higher HOMA-IR and FBS as well as increased serum hs-CRP concentration [72]. We also observed consistent results in terms of HOMA-IR and FBS. Further, there is some suggestion that higher concentration of omega-3s may have neuroprotective functions through their effects on inflammation and oxidative stress as well as insulin resistance, while omega-6s might be important mediators of inflammation by producing eicosanoid products [73,74,75,76]. As such, higher N-6/N-3 ratio in individuals with elevated scores of GRS appears to have unfavorable effects on mental health and these findings focus on the need to balance the omega-6/omega-3 essential fatty acid for prevention mental illness and improve health.

To our knowledge, our study is the first to examine the joint interaction of BMI-GRS including MC4R (rs17782313), CAV-1 (rs38 07992), and Cry1 (rs2287161) and dietary fat quality indices with mental health in overweight and obese women. As an additional strength, we applied BMI-GRS rather than specific single SNPs to identify high-risk groups and predict interactions between GRS and dietary fatty acid quality with mental health. However, some potential limitations should be considered. First of all, the cross-sectional study design prevented us establishing causality. Second, the use of self-reported dietary questionnaire is prone to reporting bias. Furthermore, the current study with small sample size included only overweight and obese women precludes the generalizability of our findings to all populations.

Conclusion

This study indicates a positive link between the ratio of N-6 to N-3 with mental health-related variables in individuals with elevated GRS, highlighting the importance of appropriate amounts of dietary omega-6 and omega-3 for management of aforementioned disorders. However, as a result of the limited literatures conducted in this area, further prospective studies in different populations will be needed to validate these findings.

Data Availability

The datasets generated and /or analyzed during the current study are not publicly available due to preserving participant anonymity but are available from the Khadijeh Mirzaei on reasonable request.

Abbreviations

GRS:

Genetic risk score

GLM:

Depression Anxiety Stress Scales

DASS-21:

Generalized linear model

MDD:

Major Depressive Disorder

GWAS:

Genome-wide association studies

SNP:

Single nucleotide polymorphism

CRY:

Cryptochrome

MC4R:

Melanocortin-4 Receptor

CAV:

Caveolin

EFA:

Essential fatty acids

BF%:

Body fat percentage

BFM:

Body fat mass

BMI:

Body mass index

CSI:

Cholestrol to saturated fat index

DBP:

Diastolic blood pressure

FBS:

Fasting blood sugar

FFM:

Fat free mass

HDL:

High density lipoprotein

HOMA:

Homeostatic model assessment

hs-CRP:

High-sensitivity C-reactive protein

PA:

Physical activity

SD:

Standard deviation

SBP:

Systolic blood pressure

TC:

Total cholesterol

TG:

Triglyceride

VFA:

Visceral fat area

WC:

Waist circumference

References

  1. Clarke DM, Currie KC. Depression, anxiety and their relationship with chronic diseases: a review of the epidemiology, risk and treatment evidence. Med J Aust. 2009;190:54–S60.

    Google Scholar 

  2. Ménard C, Hodes GE, Russo SJ. Pathogenesis of depression: insights from human and rodent studies. Neuroscience. 2016;321:138–62.

    PubMed  Google Scholar 

  3. Bartlett AA, Singh R, Hunter RG. Anxiety and epigenetics. Neuroepigenomics in Aging and Disease. 2017:145 – 66.

  4. Organization WH. Depression and other common mental disorders: global health estimates. World Health Organization; 2017.

  5. Hajebi A, Motevalian SA, Rahimi-Movaghar A, Sharifi V, Amin-Esmaeili M, Radgoodarzi R, et al. Major anxiety disorders in Iran: prevalence, sociodemographic correlates and service utilization. BMC Psychiatry. 2018;18(1):1–8.

    Google Scholar 

  6. Sadeghirad B, Haghdoost A-A, Amin-Esmaeili M, Ananloo ES, Ghaeli P, Rahimi-Movaghar A, et al. Epidemiology of major depressive disorder in Iran: a systematic review and meta-analysis. Int J Prev Med. 2010;1(2):81.

    PubMed  PubMed Central  Google Scholar 

  7. Rao TS, Asha M, Ramesh B, Rao KJ. Understanding nutrition, depression and mental illnesses. Indian J psychiatry. 2008;50(2):77.

    PubMed  PubMed Central  Google Scholar 

  8. Dunn EC, Brown RC, Dai Y, Rosand J, Nugent NR, Amstadter AB, et al. Genetic determinants of depression: recent findings and future directions. Harv Rev Psychiatry. 2015;23(1):1.

    PubMed  PubMed Central  Google Scholar 

  9. Brown HA, Murphy RC. Working towards an exegesis for lipids in biology. Nat Chem Biol. 2009;5(9):602–6.

    CAS  PubMed  PubMed Central  Google Scholar 

  10. Connor S, Artaud-Wild S, Classick-Kohn C, Gustafson J, Flavell D, Hatcher L, et al. The cholesterol/saturated-fat index: an indication of the hypercholesterolaemic and atherogenic potential of food. The Lancet. 1986;327(8492):1229–32.

    Google Scholar 

  11. Simopoulos AP. The importance of the ratio of omega-6/omega-3 essential fatty acids. Biomed Pharmacother. 2002;56(8):365–79.

    CAS  PubMed  Google Scholar 

  12. Thesing CS, Bot M, Milaneschi Y, Giltay EJ, Penninx BW. Omega-3 polyunsaturated fatty acid levels and dysregulations in biological stress systems. Psychoneuroendocrinology. 2018;97:206–15.

    CAS  PubMed  Google Scholar 

  13. Natacci L, Marchioni M, Goulart DC, Nunes A, Moreno MAB, O Cardoso A. Omega 3 consumption and anxiety disorders: a cross-sectional analysis of the brazilian longitudinal study of adult health (ELSA-Brasil). Nutrients. 2018;10(6):663.

    PubMed  PubMed Central  Google Scholar 

  14. Bozzatello P, Blua C, Rocca P, Bellino S. Mental Health in Childhood and Adolescence: the role of Polyunsaturated fatty acids. Biomedicines. 2021;9(8):850.

    CAS  PubMed  PubMed Central  Google Scholar 

  15. Deane KH, Jimoh OF, Biswas P, O’Brien A, Hanson S, Abdelhamid AS, et al. Omega-3 and polyunsaturated fat for prevention of depression and anxiety symptoms: systematic review and meta-analysis of randomised trials. Br J Psychiatry. 2021;218(3):135–42.

    PubMed  Google Scholar 

  16. Appleton KM, Voyias PD, Sallis HM, Dawson S, Ness AR, Churchill R et al. Omega-3 fatty acids for depression in adults. Cochrane Database of Systematic Reviews. 2021(11).

  17. Barnard ND, Bunner AE, Agarwal U. Saturated and trans fats and dementia: a systematic review. Neurobiol Aging. 2014;35:65–S73.

    Google Scholar 

  18. Keck MM, Vivier H, Cassisi JE, Dvorak RD, Dunn ME, Neer SM, et al. Examining the role of anxiety and depression in dietary choices among college students. Nutrients. 2020;12(7):2061.

    PubMed  PubMed Central  Google Scholar 

  19. Maulucci G, Cohen O, Daniel B, Sansone A, Petropoulou P, Filou S, et al. Fatty acid-related modulations of membrane fluidity in cells: detection and implications. Free Radic Res. 2016;50(sup1):40–S50.

    Google Scholar 

  20. Bauer AE, Liu X, Byrne EM, Sullivan PF, Wray NR, Agerbo E, et al. Genetic risk scores for major psychiatric disorders and the risk of postpartum psychiatric disorders. Translational psychiatry. 2019;9(1):1–13.

    Google Scholar 

  21. Anguita-Ruiz A, Zarza-Rebollo JA, Pérez-Gutiérrez AM, Molina E, Gutiérrez B, Bellón J, et al. Body mass index interacts with a genetic-risk score for depression increasing the risk of the disease in high-susceptibility individuals. Translational psychiatry. 2022;12(1):1–10.

    Google Scholar 

  22. Bruschetta G, Jin S, Liu Z-W, Kim JD, Diano S. MC4R signaling in dorsal raphe nucleus controls feeding, anxiety, and depression. Cell Rep. 2020;33(2):108267.

    CAS  PubMed  Google Scholar 

  23. Wang J, Zhao Q, Zhou Y, Sun W, Han S, Peng Y, et al. Subanesthetic dose of ketamine improved CFA-induced inflammatory pain and depression-like behaviors via Caveolin-1 in mice. J Neurosurg Anesthesiol. 2020;32(4):359–66.

    PubMed  Google Scholar 

  24. Onat OE, Kars ME, Gül Ş, Bilguvar K, Wu Y, Özhan A, et al. Human CRY1 variants associate with attention deficit/hyperactivity disorder. J Clin Investig. 2020;130(7):3885–900.

    CAS  PubMed  PubMed Central  Google Scholar 

  25. Wray NR, Ripke S, Mattheisen M, Trzaskowski M, Byrne EM, Abdellaoui A, et al. Genome-wide association analyses identify 44 risk variants and refine the genetic architecture of major depression. Nat Genet. 2018;50(5):668–81.

    CAS  PubMed  PubMed Central  Google Scholar 

  26. Walter S, Glymour MM, Koenen K, Liang L, Tchetgen ET, Cornelis M, et al. Do genetic risk scores for body mass index predict risk of phobic anxiety? Evidence for a shared genetic risk factor. Psychol Med. 2015;45(1):181–91.

    CAS  PubMed  Google Scholar 

  27. Guffanti G, Kumar P, Admon R, Treadway MT, Hall MH, Mehta M, et al. Depression genetic risk score is associated with anhedonia-related markers across units of analysis. Translational psychiatry. 2019;9(1):1–10.

    CAS  Google Scholar 

  28. Garver WS, Newman SB, Gonzales-Pacheco DM, Castillo JJ, Jelinek D, Heidenreich RA, et al. The genetics of childhood obesity and interaction with dietary macronutrients. Genes & nutrition. 2013;8(3):271–87.

    CAS  Google Scholar 

  29. Vallée Marcotte B, Guénard F, Marquis J, Charpagne A, Vadillo-Ortega F, Tejero ME, et al. Genetic risk score predictive of the plasma triglyceride response to an omega-3 fatty acid supplementation in a mexican population. Nutrients. 2019;11(4):737.

    PubMed  PubMed Central  Google Scholar 

  30. A T. Body composition analyzer; BC-418. Instruction Manual. 2015.

  31. Aadahl MJT. Validation of a new self-report instrument for measuring physical activity. Med Sci Sports Exerc. 2003;35(7):1196–202.

    PubMed  Google Scholar 

  32. Tanabe N. ea. Risk assessment by post-challenge plasma glucose, insulin response ratio, and other indices of insulin resistance and/or secretion for predicting the development of type 2 diabetes. Intern Med. 2009;48(6):401–9.

  33. Henry JDCJ. The short-form version of the Depression anxiety stress scales (DASS-21): construct validity and normative data in a large non-clinical sample. Br J Clin Psychol. 2005;44(2):227–39.

    PubMed  Google Scholar 

  34. Mirmiran PEF, Mehrabi Y, Hedayati M, Azizi F. Reliability and relative validity of an FFQ for nutrients in the Tehran lipid and glucose study. Public Health Nutr. 2010;13(5):654–62.

    PubMed  Google Scholar 

  35. Ghaffarpour M, H-RA H. K. The manual for household measures, cooking yields factors and edible portion of foods. Tehran: Nashre Olume Keshavarzy. 1999;7(213):42–58.

    Google Scholar 

  36. Mitchell DTKM, BB, Novascone MA. Development and validation of the cholesterol-saturated fat index (CSI) scorecard: a dietary self-monitoring tool. J Am Diet Assoc. 1996;96:132–6.

    CAS  PubMed  Google Scholar 

  37. S A. The importance of the ratio of omega-6/omega-3 essential fatty acids. Biomed Pharmacother Elsevier Masson. 2002;56:365–79.

  38. Connor SLGJ, Artaud-Wild SM, Flavell DP, Classick-Kohn CJ, Hatcher LF, et al. The cholesterol/saturated-fat index: an indication of the hypercholesterolaemic and atherogenic potential of food. Lancet (London England). 1986;1(8492):1229–32.

    CAS  PubMed  Google Scholar 

  39. Miller SADD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16(3):1215.

    CAS  PubMed  PubMed Central  Google Scholar 

  40. Myakishev MVKY, Hu S, Hamer DH. High-throughput SNP genotyping by allele-specific PCR with universal energy-transfer-labeled primers. Genome Res. 2001;11(1):163–9.

    CAS  PubMed  PubMed Central  Google Scholar 

  41. Zlatohlavek LVM, Motykova E, Ceska R, Vasickova L, Dlouha D, et al. FTO and MC4R gene variants determine BMI changes in children after intensive lifestyle intervention. Clin Biochem. 2013;46(4–5):313–6.

    CAS  PubMed  Google Scholar 

  42. Abaj FKF, RM, Alvandi E, Yekaninejad MS, Mirzaei K. Interactions between Caveolin-1 (rs3807992) polymorphism and major dietary patterns on cardio-metabolic risk factors among obese and overweight women. BMC Endocr Disorders. 2021;21(1):1–14.

    Google Scholar 

  43. Yu KLL, Zhang L, Guo L, Wang C. Association between MC4R rs17782313 genotype and obesity: a meta-analysis. Gene. 2020;733:144372.

    CAS  PubMed  Google Scholar 

  44. Tangestani HEH, Yekaninejad MS, Keshavarz SA, Mirzaei K. Variants in Circadian Rhythm Gene Cry1 interacts with healthy Dietary Pattern for serum leptin levels: a cross-sectional study. Clin Nutr Res. 2021;10(1):48–58.

    PubMed  PubMed Central  Google Scholar 

  45. Miranda AMSJ, Norde MM, Fisberg RM, Marchioni DM. The association between genetic risk score and blood pressure is modified by coffee consumption: gene-diet interaction analysis in a population-based study. Clin Nutr. 2019;38(4):1721–8.

    PubMed  Google Scholar 

  46. Chang C-C, CC-Y, Wen H-C, Huang C-Y, Hung M-S, Lu H-C, et al. Caveolin-1 secreted from adipose tissues and adipocytes functions as an adipogenesis enhancer. Obes [Internet]. 2017;25(11):1932–40.

    CAS  Google Scholar 

  47. Liang YNLY, Wang L, et al. Combined caveolin-1 and epidermal growth factor receptor expression as a prognostic marker for breast cancer. Oncol Lett. 2018;15:9271–82.

    PubMed  PubMed Central  Google Scholar 

  48. Takayasu YTK, Kumari R, et al. Caveolin-1 knockout mice exhibit impaired induction of mGluR-dependent long-term depression at CA3-CA1 synapses. Proc Natl Acad Sci U S A. 2010;107:21778–83.

    CAS  PubMed  PubMed Central  Google Scholar 

  49. Horstmann AKP, Kabisch S, Boettcher Y, Schloegl H, Tonjes A, Stumvoll M, Pleger B. Villringer A Common genetic variation near MC4R has a sex-specific impact on human brain structure and eating behavior. PLoS ONE. 2013;8:e74362.

    CAS  PubMed  PubMed Central  Google Scholar 

  50. Park SDJ, Zhang X, Jin HS, Lee HJ, Lee YH. Interactions with the MC4R rs17782313 variant, mental stress and energy intake and the risk of obesity in Genome Epidemiology Study Nutr Metab (Lond). 2016;21;13:38.

  51. Hua PLW, Chen D, Zhao Y, Chen L, Zhang N, Wang C, Guo S, Wang L, Xiao H, Kuo SH. Cry1 and tef gene polymorphisms are associated with major depressive disorder in the chinese population. J Affect Disord. 2014;157:100–3.

    CAS  PubMed  Google Scholar 

  52. Mulugeta AZA, King C, Hyppönen E. Association between major depressive disorder and multiple disease outcomes: a phenome-wide mendelian randomisation study in the UK Biobank. Mol Psychiatry. 2020;25(7):1469–76.

    PubMed  Google Scholar 

  53. Anguita-Ruiz A, Z-RJ, Pérez-Gutiérrez AM, Molina E, Gutiérrez B, Bellón J, Moreno-Peral P, Conejo-Cerón S, Aiarzagüena JM, Ballesta-Rodríguez MI, Fernández A, Fernández-Alonso C, Martín-Pérez C, Montón-Franco C, Rodríguez-Bayón A, Torres-Martos Á, López-Isac E, Cervilla J, Rivera M. Body mass index interacts with a genetic-risk score for depression increasing the risk of the disease in high-susceptibility individuals. Transl Psychiatry. 2022;24(1):30.

    Google Scholar 

  54. Kivimaki MJM, Hamer M, et al. Examining overweight and obesity as risk factors for common mental disorders using fat mass and obesity-associated (FTO) genotype-instrumented analysis: the Whitehall II study, 1985–2004. Am J Epidemiol. 2011;173:421–29.

    PubMed  PubMed Central  Google Scholar 

  55. Wray NRSP. Genome-wide association analyses identify 44 risk variants and refine the genetic architecture of major depression. Nat Genet. 2018;50:668–81.

    CAS  PubMed  PubMed Central  Google Scholar 

  56. Walter SGM, Koenen K, Liang L, Tchetgen Tchetgen EJ, Cornelis M, Chang SC, Rewak M, Rimm E, Kawachi I, Kubzansky LD. Do genetic risk scores for body mass index predict risk of phobic anxiety? Evidence for a shared genetic risk factor. Psychol Med. 2015;45(1):181–91.

    CAS  PubMed  Google Scholar 

  57. Poppitt SDPA. Energy density and its role in the control of food intake: evidence from metabolic and community studies. Appetite. 1996;26(2):153–74.

    CAS  PubMed  Google Scholar 

  58. Jéquier ETL. Regulation of body weight in humans. Physiol Rev. 1999;79(2):451–80.

    PubMed  Google Scholar 

  59. Sonestedt ERC, Gullberg B, Ericson U, Wirfält E, OrhoMelander M. Fat and carbohydrate intake modify the association between genetic variation in the FTO genotype and obesity. Am J Clin Nutr. 2009;90(5):1418–25.

    CAS  PubMed  Google Scholar 

  60. Corella DAD, Tucker KL, et al. A high intake of saturated fatty acids strengthens the association between the fat mass and obesityassociated gene and BMI. J Nutr. 2011;141(12):2219–25.

    CAS  PubMed  PubMed Central  Google Scholar 

  61. Moleres AOM, Rendo-Urteaga T, et al. Dietary fatty acid distribution modifies obesity risk linked to the rs9939609 polymorphism of the fat mass and obesity-associated gene in a spanish case-control study of children. Br J Nutr. 2012;107(4):533–8.

    CAS  PubMed  Google Scholar 

  62. Casas-Agustench PAD, Smith CE, Lai CQ, Parnell LD, Borecki IB, Frazier-Wood AC, Allison M, Chen YD, Taylor KD, Rich SS, Rotter JI, Lee YC, Ordovás JM. Saturated fat intake modulates the association between an obesity genetic risk score and body mass index in two US populations. J Acad Nutr Diet. 2014;114(12):1954–66.

    PubMed  PubMed Central  Google Scholar 

  63. Huang TWT, Heianza Y, Zheng Y, Sun D, Kang JH, Pasquale LR, Rimm EB, Manson JE, Hu FB, Qi L. Habitual consumption of long-chain n-3 PUFAs and fish attenuates genetically associated long-term weight gain. Am J Clin Nutr. 2019;1(3):665–73.

    Google Scholar 

  64. Pouget JG, Gonçalves VF, Schizophrenia Working Group of the Psychiatric Genomics Consortium, Spain SL, Finucane HK, Raychaudhuri S, Kennedy JL, Knight J. Genome-wide association studies suggest limited immune gene enrichment in schizophrenia compared to 5 autoimmune diseases. Schizophr Bull. 2016;42:1176–84.

    PubMed  PubMed Central  Google Scholar 

  65. Sekar A, Bialas AR, de Rivera H, Davis A, Hammond TR, Kamitaki N, Tooley K, Presumey J, Baum M, Van Doren V, Genovese G, Rose SA, Handsaker RE, Daly MJ, Carroll MC, Stevens B, McCarroll SA. Schizophrenia risk from complex variation of complement component 4. Nature. 2016;530:177–83. ,Schizophrenia Working Group of the Psychiatric Genomics Consortium.

    CAS  PubMed  PubMed Central  Google Scholar 

  66. Nousen EKFJ, Sullivan EL. Unraveling the Mechanisms responsible for the comorbidity between metabolic syndrome and Mental Health Disorders. Neuroendocrinology. 2013;98:254–66.

    CAS  PubMed  Google Scholar 

  67. Maes MSR, Christophe A, Cosyns P, Desnyder R, Meltzer H. Fatty acid composition in major depression: decreased omega 3 fractions in cholesteryl esters and increased C20:4 omega 6/C20:5 omega 3 ratio in cholesteryl esters and phospholipids. J Affect Disord. 1996;38(1):35–46.

    CAS  PubMed  Google Scholar 

  68. Kitagishi YKM, Kikuta K, Matsuda S. Roles of PI3K/AKT/GSK3/m TOR path way in cell signaling of mental illnesses. Depressio n Res Treat. 2012;2012:1–8.

    Google Scholar 

  69. Lawlor DADSG, Ebrahim S, British WH, Health S. Association of insulin resistance with depression: cross sectional findings from the British Women’s Heart and Health Study. BMJ. 2003;327:1383–84.

    PubMed  PubMed Central  Google Scholar 

  70. Miller AHRC. The role of inflammation in depression: from evolutionary imperative to modern treatment target. Nat Rev Immunol. 2016;16:22–34.

    CAS  PubMed  PubMed Central  Google Scholar 

  71. Zhang LLP, Guo B, Xu Y, Rubin LH, Hill SK, Alliey-Rodriguez N, Lee AM, Wu B, Keedy SK, Tamminga CA, Pearlson GD, Clementz BA, Keshavan MS, Gershon ES, Sweeney JA, Bishop JR. Inflammation subtypes in psychosis and their relationships with genetic risk for psychiatric and cardiometabolic disorders. Brain Behav Immun Health. 2022;8:22:100459.

    Google Scholar 

  72. Serra MCRA, Hafer-Macko CE, Yepes M, Nahab FB, Ziegler TR. Dietary and serum Omega-6/Omega-3 fatty acids are Associated with Physical and metabolic function in stroke survivors. Nutrients. 2020;6(3):701.

    Google Scholar 

  73. Reinders IAM, Song R, Visser X, Cotch M, Lang MF, Garcia TF;E, Launer M, Siggeirsdottir LJ, Eiriksdottir K. Polyunsaturated fatty acids in relation to incident mobility disability and decline in gait speed; the Age, Gene/Environment Susceptibility-Reykjavik Study. Eur J Clin Nutr. 2015;69:489–93.

    CAS  PubMed  PubMed Central  Google Scholar 

  74. Albert BBD, Brennan JGB, Biggs CM, Smith JB, Garg GC, Cameron-Smith ML, Hofman D, Cutfield PL. Higher omega-3 index is associated with increased insulin sensitivity and more favourable metabolic profile in middle-aged overweight men. Sci Rep. 2014;4:6697.

    CAS  PubMed  PubMed Central  Google Scholar 

  75. Sibille KTK, Garrett C, Glover TJ, Zhang TL, Chen H, Reddy H, Goodin D, Sotolongo BR, Petrov A. Omega-6: Omega-3 PUFA ratio, Pain, Functioning, and distress in adults with knee Pain Clin. J Pain. 2018;34:182–9.

    Google Scholar 

  76. Jeromson SG, Galloway I, Hamilton SD. Omega-3 fatty acids and skeletal muscle health. Mar Drugs. 2015;13:6977–7004.

    CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

The authors thank the laboratory of Nutrition Sciences and Dietetics in Tehran University of Medical Sciences (TUMS). We are grateful to all of the participants for their contribution to this research. This study was approved by the Research ethics committee of the Tehran University of Medical Sciences (TUMS), Tehran, Iran with ethics number IR.TUMS.MEDICINE.REC.1399.636. All participants signed a written informed consent that was approved by this committee prior to enrollment in the study.

Funding

This study was supported by TUMS and grant ID was 99-3212-51715.

Author information

Authors and Affiliations

  1. Department of Community Nutrition, School of Nutritional Sciences and Dietetics, Tehran University of Medical Sciences (TUMS), Tehran, Iran

    Niloufar Rasaei, Mahsa Samadi, Fatemeh Gholami & Khadijeh Mirzaei

  2. Network of Interdisciplinarity in Neonates and Infants (NINI), Universal Scientific Education and Research Network (USERN), Tehran, Iran

    Niloufar Rasaei

  3. Department of Nutrition, Science and Research Branch, Islamic Azad University, Tehran, Iran

    Alireza Khadem

  4. Department of Nutrition, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran

    Seyedeh Fatemeh Fatemi

  5. Food Microbiology Research Center, Tehran University of Medical Sciences, Tehran, Iran

    Khadijeh Mirzaei

Authors
  1. Niloufar Rasaei
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Mahsa Samadi
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Alireza Khadem
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Seyedeh Fatemeh Fatemi
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Fatemeh Gholami
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Khadijeh Mirzaei
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Niloufar Rasaei and Khadijeh Mirzaei designed the search; Niloufar Rasaei and Khadijeh Mirzaei conducted the sampling; Niloufar Rasaei and Fatemeh Gholami performed statistical analysis; Niloufar Rasaei, Mahsa Samadi, Alireza Khadem, Fatemeh Fatemi, Fatemeh Gholami, and Khadijeh Mirzaei wrote the paper, Khadijeh Mirzaei primary responsibility for final content. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Khadijeh Mirzaei.

Ethics declarations

Ethics approval and consent to participate

This investigation was approved by the Ethics Committee of Tehran University of Medical Sciences, Tehran, Iran (with ethics number: IR.TUMS.VCR.REC.1399.636). All methods were carried out in accordance with relevant guidelines and regulations. All of the study participants signed a written consent form related to this study. Each individual was informed completely regarding the study protocol and provided a written and informed consent form before taking part in the study. literate family members of illiterate participants provided informed consent for the study and this method is approved by the Ethics Committee of Tehran University of Medical Sciences, Tehran, Iran.‘

Consent for publication

Not applicable.

Conflict of Interest

There are no competing financial interests in relation to the current study

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Rasaei, N., Samadi, M., Khadem, A. et al. Investigation of the interaction between Genetic Risk Score (GRS) and fatty acid quality indices on mental health among overweight and obese women. BMC Women's Health 23, 413 (2023). https://doi.org/10.1186/s12905-023-02491-0

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12905-023-02491-0

Keywords

BMC Women's Health

ISSN: 1472-6874

Contact us